Cd

Fig. 2 Biogenesis of miRNAs. Transcription of viral pri-miRNA occurs most often by RNA polymerase II. Pri-miRNAs are then capped and polyadenylated. Nuclear RNase type III endonu-clease Drosha then processes the pri-miRNA to pre-miRNA. Pre-miRNAs contain 2-nt 3' overhangs characteristic of processing by RNase type III nucleases. Pre-miRNA is then exported via exportin-5 from the nucleus. Cytoplasmic type III endonuclease Dicer then cleaves the stem loop of the pre-miRNA to yield a 22-nt dsRNA. The strand with lowest thermodynamic stability at its 5' end is chosen as the guide strand and incorporated into the RISC complex. The strand not chosen for incorporation is typically degraded. Guide strand miRNA enables recognition of target mRNA by RISC. Target mRNAs are then either cleaved or translation is inhibited

Fig. 2 Biogenesis of miRNAs. Transcription of viral pri-miRNA occurs most often by RNA polymerase II. Pri-miRNAs are then capped and polyadenylated. Nuclear RNase type III endonu-clease Drosha then processes the pri-miRNA to pre-miRNA. Pre-miRNAs contain 2-nt 3' overhangs characteristic of processing by RNase type III nucleases. Pre-miRNA is then exported via exportin-5 from the nucleus. Cytoplasmic type III endonuclease Dicer then cleaves the stem loop of the pre-miRNA to yield a 22-nt dsRNA. The strand with lowest thermodynamic stability at its 5' end is chosen as the guide strand and incorporated into the RISC complex. The strand not chosen for incorporation is typically degraded. Guide strand miRNA enables recognition of target mRNA by RISC. Target mRNAs are then either cleaved or translation is inhibited

(Pfeffer et al. 2005). As such, the reader is encouraged to pursue the topics included in this section with the host-microbe interaction in mind.

The miRNA transcriptional unit is termed a primary miRNA (pri-miRNA). The pri-miRNA may possess multiple hairpins or single hairpins (Kim 2005). While most miRNAs are located within an intron of a protein-coding transcript, miRNAs can be found in the exons as well as the protein coding potential of the transcriptional unit (Rodriguez et al. 2004). Finally, some pri-miRNAs are found in intergenic regions whereby they contain their own promoters and are independently transcribed (Zeng 2006).

Transcription of most pri-miRNAs is RNA polymerase Il-dependent (Lee et al. 2004). Notable exceptions include the MHV68 miRNAs, whose expression is believed to be driven by a pol III promoter (Pfeffer et al. 2005). Pol Il-dependent pri-miRNAs possess 5' cap structures and are polyadenylated (Cullen 2004). Due to the enormity and diversity of pol II-associated transcription factors, pol II-dependent transcription allows for the exquisite temporal and spatial control characteristic of miRNAs.

Following transcription, an approximately 65-nt hairpin with a 2-nt 3' overhang is excised from the pri-miRNA by the nuclear Microprocessor (Gregory et al. 2004). Microprocessor consists of the RNase III type endonuclease Drosha in complex with the cofactor DGCR8 (Han et al. 2004). These two components of Microprocessor are both necessary and sufficient to affect cleavage in vitro. Using mutagenesis and in vitro processing assays, it was determined that Microprocessor recognition of pri-miRNA is through the ssRNA flanking strands and the structural motif of the hairpin (Han et al. 2006). Recent studies suggest that pri-miRNA processing to mature miRNAs is a regulated step in miRNA biogenesis. Mature miRNAs have been found in fully differentiated cells, while the pri-miRNAs accumulate in undifferentiated cells (Thomson et al. 2006). Additionally, in human tumors pri-miRNAs are expressed at high levels while the formation of mature miRNA is downregulated (Thomson et al. 2006). This suggests that there may be additional cofactors modulating either substrate specificity and/or activity of Microprocessor.

Following conversion of pri-miRNA to pre-miRNA, Exportin-5, in a Ran-GTP-dependant manner, exports the pre-miRNA from the nucleus to the cytoplasm (Lund et al. 2004). A cytoplasmic RNase III type endonuclease, Dicer, then removes the stem loop from the pre-miRNA converting it to a 22-bp dsRNA with 2-nt 3' overhangs on each strand (Carmell and Hannon 2004). Evidence suggests that pre-miRNA processing to mature miRNAs is also subject to regulation. It is unclear whether this is due to regulation of pre-miRNA export from the nucleus, or due to the presence of cofactors, which may influence substrate specificity, and/or activity of Dicer cleavage (Lund and Dahlberg 2006; Obernosterer et al. 2006).

Typically, one strand of the 22-bp dsRNA, designated the guide strand, is fated to pair with a target mRNA to facilitate translation inhibition or cleavage of the target mRNA. The guide strand is chosen based on lower thermodynamic stability at its 5' end in the duplex RNA (Khvorova et al. 2003; Schwarz et al. 2003). Incorporation of the guide strand in the miRISC enables identification of target mRNA for either translation inhibition or cleavage.

Mammalian miRISC is at minimum comprised of Dicer, Argonaute proteins, TRBP, and PACT (Rana 2007). In general, translation inhibition occurs if there is imperfect complementarity of the guide strand with the target mRNA. Cleavage occurs if the complementarity between the guide strand and the target mRNA is perfect. Nucleotides 2-7 of the miRNA constitute the seed region of the miRNA

and appear to be critical for miRNA-target mRNA recognition (Jackson and Standart 2007).

The major functional consequence of miRNA biogenesis is alteration of protein concentration through either translation inhibition or cleavage of mRNA. It is important to note that operationally miRNA-mediated inhibition of gene expression is not necessarily an all-or-nothing mechanism. Rather, the present consensus is that miRNAs allows a fine tuning of gene expression (Bartel 2004). miRNAs may be seen as a means by which the cell or virus can achieve a spectrum of gene expression levels appropriate to differentiation or developmental states, proliferative signals, and most recently in response to infection. As such, it is not difficult to imagine a role for viral miRNAs, particularly in those viruses that find persistence and/or latency part of their life cycle.

Location and Conservation of HCMV miRNAs Mapping of HCMV miRNAs

Using a small RNA cloning and sequencing approach, a total number of 14 mature HCMV miRNAs were identified, which arise from 11 pre-miRNAs (Fig. 1) (Dunn et al., 2005: Grey et al., 2005; Pfeffer et al., 2005). In order to correlate our previous work (Dunn et al. 2003), where we functionally profiled the HCMV genome by constructing a deletion mutant library, with the discovery of HCMV miRNAs, we have mapped the HCMV miRNAs to the genome of the HCMV Towne (HCMV Towne-BAC) strain that was cloned as a bacterial artificial chromosome (Fig. 3). Our annotation of open reading frames (ORFs) within the HCMV Towne-BAC reveals that five HCMV pre-miRNAs are intergenic, four are found within ORFs and two partially overlap annotated ORFs. The vector for bacterial propagation of the Towne-BAC replaces ORFs US1-US12. Additionally, a well-characterized spontaneous deletion of UL150 has occurred on passaging of Towne in tissue culture. To map miRNAs in these regions, we have deferred to other publications for their annotation (Grey et al. 2005; Pfeffer et al. 2005). From the map and data generated by the deletion mutant library, we have determined that six of the miRNAs (mir-US4, mir-US5-1, mir-US5-2, mir US25-2, mir-US33 and mir-UL148D) are not essential for growth in tissue culture. These six miRNAs along with their associated ORFs have been deleted from the viral genome with no apparent resulting defect in viral replication in tissue culture. The possibility remains, however, that these miRNA targeted the ORFs in which they are found, and that concomitant deletion of both the miRNA and its target ORF precluded any phenotype we may have observed if only the miRNA had been disrupted. The two deletions that did result in a phenotype (UL70 and UL114) are in ORFs whose gene products are known to be important for viral infection (Pari and Anders 1993; Courcelle et al. 2001). This precludes determining the contribution that the deletion of miRNAs in these ORFs makes to viral growth

26 50 100 104 162 164 200 204 217 225kb

26 50 100 104 162 164 200 204 217 225kb

192 194

Fig. 3 Map of HCMV miRNAs. Relative positions of HCMV miRNAs were mapped by aligning the sequence of 11 miRNAs found in the miRNA registry with the Towne BAC sequence. The Towne BAC genome (illustrated in the middle) consists of two unique regions bracketed by repeat regions. Regions of the genome containing miRNAs have been expanded. The Towne BAC is missing ORFs US 1-11 and UL150. To accommodate HCMV miRNAs in these regions, we have used the HCMV Merlin sequence, which possesses a similar arrangement of ORFs as Towne BAC. Growth phenotype of deletion mutants is indicated for ORFs that either contain or immediately surround HCMV miRNAs. Scale in kilobase pairs

192 194

Fig. 3 Map of HCMV miRNAs. Relative positions of HCMV miRNAs were mapped by aligning the sequence of 11 miRNAs found in the miRNA registry with the Towne BAC sequence. The Towne BAC genome (illustrated in the middle) consists of two unique regions bracketed by repeat regions. Regions of the genome containing miRNAs have been expanded. The Towne BAC is missing ORFs US 1-11 and UL150. To accommodate HCMV miRNAs in these regions, we have used the HCMV Merlin sequence, which possesses a similar arrangement of ORFs as Towne BAC. Growth phenotype of deletion mutants is indicated for ORFs that either contain or immediately surround HCMV miRNAs. Scale in kilobase pairs in tissue culture. Characterizing the contribution that the remaining HCMV miRNAs (mir-UL22A-1, mir-UL36 and mir-US25-1) make to virus growth in tissue culture awaits the generation of novel recombinant virus.

HCMV is the only betaherpesvirus in which miRNAs have been described, and several aspects of HCMV miRNAs are unique. Firstly, unlike the miRNAs identified in alpha- and gammaherpesviruses, HCMV miRNAs are not found clustered in small regions of the genome, but can be found up to 195 kb apart (Fig. 3). Secondly, due to the diversity of cells permissive to HCMV infection, it is possible to study the expression of viral miRNAs in a number of cell types. Thirdly, because of the lack of a simple in vitro model for HCMV latency, all of the HCMV miRNAs identified in the experiments above have been in cells lytically infected with HCMV. Thus far, all miRNAs identified in prototypic human alpha-(herpes simplex virus 1 [HSV-1] and gamma-Kaposi's sarcoma associated herpesvirus [KSHV] and EBV) herpes viruses have been found in regions of the genome that are transcrip-tionally active during latent infection. The similarities and differences between HCMV miRNAs and other herpesvirus miRNAs, in terms of their genomic arrangement, expression and conservation will be discussed below.

HCMV miRNA Conservation

Multiple ORFs are conserved throughout the herpesvirus family, which are referred to as core herpesvirus ORFs. As none of the miRNAs identified thus far are conserved among the human herpesviruses, it can be inferred, just as it is for the non-core herpesvirus ORFs, that these miRNAs impart functions unique to the identity and lifestyle of each virus.

Our lab was the first to show the conservation of miRNAs between primate her-pesviruses of the same genera, HCMV and chimpanzee cytomegalovirus (CCMV) (Dunn et al. 2005). For purposes of this review, we have extended our analysis to include all HCMV miRNAs identified to date and we report here that at least five of the HCMV miRNAs are 100% conserved in CCMV (Fig. 4). Related herpesviruses are expected to have diverged with their host species. Chimpanzee and human are thought to have diverged approximately 5 million years ago and as such, CCMV is the closest relative of HCMV (Davison et al. 2003).

Similar analysis of the conservation of miRNAs between EBV and the closely related rhesus lymphocryptovirus (rLCV) revealed that at least seven of the EBV miRNAs are conserved in rLCV (Cai et al. 2006). The strength of this report lies in the fact that bioinformatics were not used to identify rLCV miRNAs. Rather, rLCV miRNAs were cloned from infected cells prior to sequence analysis. Interestingly, the rLCV miRNAs that have sequence identity with EBV BART miRNAs possess identical synteny with EBV BART miRNAs (Cai et al. 2006).

Two human herpesviruses, HSV-1 and HSV-2, exhibit close homology. Eight of the miRNAs predicted for HSV-1 were conserved in HSV-2 (Pfeffer et al. 2005; Cui et al. 2006). Of the eight, two of the precursor miRNAs were conserved in HSV-2 (Pfeffer a HCMV premirUS33

hcmv cacggttgattgtgcccggaccgtgggcgcgacgaaacccaccgtcacggtccgagcacatccaaacgtg 213434-i) 21350 ( c)

ccmv cacggttgattgtgcccggaccgtgggcgcgacgagaflccaccgtcacggtccgagcacatccaaacgtg 232503-

232572(c)

HCMV premir US33

iii)

hcmv gtccgctctgagccggctccgccgtcggaaacccgacgagacaacaatgacacgtcttacttcagcagca ccmv gtHEctctgagccB

b HCMV premirUL112 i)

hcmv gacagcctccggatcacatggttactcagcgtctgccagcctaagtgacggtgagatccaggctgtc 152854 -152920 ccmv GACAGCCT0CGGATCACAgGC^actcagcgtctgccagcctaagtgacggtgagatccaggctgtc 165729- 165795

HCMV premir UL112

Was this article helpful?

0 0

Post a comment