Therapeutic Effects of A 24 321 Effects of A 24 on Glioma Cells

The anticancer effects of Delta 24 have been demonstrated in a large number of glioma cell lines. The lines tested have included cells that harbored a mutation in Rb itself, although the majority had disruption of the p16/Rb/E2F pathway (see Fig. 5). In vitro viability assays have shown a dose-dependent killing of glioma cell lines, with cytopathic effects occurring at titers as little as 0.5 to 1 viral particle/cell (17). Lysis of glioma cells was observed within 10 to 14 d after infection with A 24 in vitro (17). Moreover, these anticancer effects were shown to be caused by the replication of A 24, and studies analyzing the supernatant of A 24-infected tumor cells for progeny virus have shown an increase in the viral titers of 60 to 400x the initial infection titer as early as 6 d after initial infection, with the amount increase depending on the cell line tested. These studies, as well as cell-cycle analyses, confirm that lysis is the primary mode of cell death, although a small amount of apoptosis also occurs.

In vivo studies have demonstrated that treatment with A 24 significantly reduces the growth of subcutaneously grown glioma xenografts compared with controls treated with ultraviolet (UV)-inactivated-A 24, (17). Similarly, the survival time of animals harboring intracranially established glioma xenografts was significantly extended after treatment with A 24 relative to controls treated with UV-inactivated A 24 or saline (18). Most importantly, detailed histological analysis of A 24-treated tumors identified three zones of viral expression that are best explained by a wave-like movement of the vector from the injection site toward the edge of the tumor (see Fig. 6). Thus, there is substantial evidence that A 24 is effective as an anticancer agent against gliomas. Evidence e1a

560 1545

560 1545

923 cttacctgccaggaggctggcttt 946

Fig. 4. The A 24 Construct. A 24 contains a deletion of 24 bp in the E1A region.

Fig. 4. The A 24 Construct. A 24 contains a deletion of 24 bp in the E1A region.

Was this article helpful?

0 0
10 Ways To Fight Off Cancer

10 Ways To Fight Off Cancer

Learning About 10 Ways Fight Off Cancer Can Have Amazing Benefits For Your Life The Best Tips On How To Keep This Killer At Bay Discovering that you or a loved one has cancer can be utterly terrifying. All the same, once you comprehend the causes of cancer and learn how to reverse those causes, you or your loved one may have more than a fighting chance of beating out cancer.

Get My Free Ebook


Post a comment